Accès membres

Mot de passe perdu? S'inscrire

15-12-2025 07:05

Danny Newman Danny Newman

Pseudosclerococcum golindoi (det: Zotto)near Cosb

15-12-2025 12:34

Danny Newman Danny Newman

indet. Rhytismataceae on oak leafnear Purchase Roa

09-12-2025 12:06

Andgelo Mombert Andgelo Mombert

Bonjour,Je recherche l'article concernant Hypobryo

13-12-2025 17:26

Buckwheat Pete

Hello everyone,I have a rather interesting ascomyc

13-12-2025 11:58

Mirek Gryc

HiSupposedly this is a species that occurs quite o

12-12-2025 18:39

Mirek Gryc

Hello everyone.Macrofeatures similar to Mollisia b

07-12-2025 16:07

Arnold Büschlen

Hallo, ich habe in einer Moos-Aufsammlung (epiphy

08-12-2025 21:04

Mark Stevens

"Hello everyone,I'm relatively new to microscopy (

08-12-2025 18:59

Lothar Krieglsteiner Lothar Krieglsteiner

.. found by a seminar-participant, I do not know t

08-12-2025 21:18

Buckwheat Pete

Hello everyone, Is it possible to at least approx

« < 24 25 26 27 28 > »
Pseudosclerococcum golindoi (det: Zotto)
Danny Newman, 15-12-2025 07:05
Danny NewmanPseudosclerococcum golindoi (det: Zotto)
near Cosby Campground, Great Smoky Mountains National Park, Cocke County, Tennessee, USA


Collected during the 2025 Richard P. Korf Memorial North American Ascomycete Foray (aka "The Korf Foray), held at the Appalachian Highlands Science Learning Center in Purchase Knob, North Carolina.


2x ITS sequences were generated from this material, one matching Orbilia dryadum, while the other is very close to Papillospora hebetiseta. both have thus far been considered to be "off-target," as in sequences of a fungus which is not the focus of the collection/observation in question.


only two spores were ever able to be observed outside of asci, as seen in the first micrograph (credit: Connor Dooley). otherwise, photo credits are as follows:


macro photography: Connor Dooley

micrographs: Patrick A Verdier


some comments on microscopy from Patrick:

"The hymenium was embedded in an extracellular gel with odd iodine staining, sometimes maroon (high iodine) sometimes teal (low iodine) suggesting a strange mix of amyloid/dextrinoid, with some carotenoids thrown in. Paraphyses swollen tips included a weird doughnut shaped structure, in fresh specimens at least. Paraphyses tips were also highly absorbent in blue light, and even more so in UV light (using a monochrome camera and UV light source)"



crossposted to the Ascomycetes of the World FB group at https://www.facebook.com/groups/ascomycetes/posts/4143399475912225
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
  • message #84063
Hans-Otto Baral, 15-12-2025 08:40
Hans-Otto Baral
Re : indet. discomycete on wood (unk.)
Hi Danny

this should be Pseudosclerococcum golindoi. The spores in the type measured 10-12 x 4.5-5.5 and were 1-septate.

See paper Olariaga et al. , Mycological Progress (2019) 18:895–905
https://doi.org/10.1007/s11557-019-01500-7

Zotto
Danny Newman, 15-12-2025 09:11
Danny Newman
Re : indet. discomycete on wood (unk.)
thank you as always, Zotto.  I have added this genus and species to the nomenclatural database on iNat and credited you for the determination on the observation.  your expertise continues to be without equal.  the entire Korf Foray is grateful for your assistance.
Danny Newman, 15-12-2025 12:56
Danny Newman
Re : Pseudosclerococcum golindoi (det: Zotto)
one thing I've just noticed:

we generated two, inconclusive sequences from this material, as mentioned in the original post.

they are as follows:

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCAAACTGATAGATTCTTCTGCAGTGACGCCTTTGGAAGCCTTTGTGGCCCCGCAAGGGGTATTCACGGCGACTATAAACAAGAATGTGAGTATTAAATCGCAAGTCGGCCACCAGCGGCCGGCGACACTTTCGAATTGCGGGGAATCCCTAAAGCCCATCTCTACCAACCCGGCGCGGAAACGCGCGGGGGGCCGGTGCTAATCACACCGGGGCGGTAACAATGAGATGGGATAGACAGCATGGGCAATCCGCAGCCAAGTCCCTAAGGCGAGAGCTATGGGAAAGGTTCACAGACTAAGTGGAAGTGGGTTGGGGCCGGTGTGCCCCAGCTTAAGATATAGTCGGGCTTGATGAGAAATCGTCGGGGAGTCACTGGACTAAACATAAACTGTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAGAAAAGGCTTTGCGCCGGGCCCGTCCCGGACAGAGTTCAACCCTTTGTGAAAAACAACCTTCTTTTCGCTTCGGCAGCTCGCGCTCGCGCGGTCAGCCTGCCGGCAGCACCAAAAATATCAACCTGTCTCTGTAGATAATGTCTGACCATTCTGAATTGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCGTCGGCATTCCGACGGGCACGTCTGTCTGAGCGTCATGTCAAATCTCTGCTGGCCTGGGTTTGCGCCCGGTCAGCCGGTACTGAGCTGCGGTCTCCCAACCGGAACTGCGCTTTAAAGTGGCACGCTCTGCGGGTCTGACCGCTTCGAGAACATAGTATAATGCTATCTGTTCCAGGAGCCGGCTCAGGCAACCGCCTGAACAAATCTTCTATTAGGTTTGACCTCAGATCAGACGAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGGACTCGCAAGACTCCCTAAACCCTCGTGAACCTACCGAAACGTTGCCTCGGCGGGCGCCCGGCCTCTCGCGCCGGGCGCTGCGCCCGCCGGCGGCCCCCTACTCTGTCTCTGCAGCGTTGGCATCTCCGAGTATATACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCCACCCTCAGGCTCGGCCTGGTGTTGGGGGCCTGCCGCGCGCAGCCCCCGAAAGACAGCGGCGGTCCCGATCCCGGCTCCGAGCGTAGTAATACACGTCGCTCTGGGCGCCTGGCGGGCTTCCAGCCGGAAACCTCACATATCAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

they bear a 90-92% similarity to the GenBank accession for the ITS sequence of the type of P. golindoi (https://www.ncbi.nlm.nih.gov/nuccore/MK759885.1).

I wonder, Zotto, if you could comment on the accuracy/usefulness of either of these sequences.  I was expecting them to be much more dissimilar to MK759885.1 if they truly belonged to contaminants.  Perhaps one of them is "good," and this is merely evidence of significant variation in ITS sequences in this taxon?
Hans-Otto Baral, 15-12-2025 15:24
Hans-Otto Baral
Re : Pseudosclerococcum golindoi (det: Zotto)
How I do it: Search for ATCATTA and TGACCT and copy the part between (wihich is ITS and 5.8S) into GenBank Blast search. 

The first sequence gives 99.6% Orbilia dryadum. So this is clearly this Orbilia species.

The second gives with 98.5% Papillospora henetiseta (Chaetosphaeriaceae).

In the alignment of Sclerococcales I saw at once that it is something different.