22-12-2024 10:19
Simon Gurtner
Hello,can anyone help me identify this small ascom
20-12-2024 17:32
Louis DENYBonsoir forumTrouvé à Belfort, 400 m altitude, s
22-12-2024 10:53
Bernard CLESSE
Pourriez-vous me confirmer ma détermination de ce
17-02-2013 08:38
Alain GARDIENNET
Bonjour, J'ai trouvé ces acervules sur feuille d
21-12-2024 09:08
Castillo Joseba
Me mandan el material seco de Galicia, recolecta
21-12-2024 12:45
Marc Detollenaere
Dear Forum,On naked wood of Fagus, I found some ha
17-12-2024 12:33
Lothar Krieglsteiner
this fluffy anamorph was repeatedly found on decid
20-12-2024 20:30
Bernard CLESSE
Bonsoir à toutes et tous,Pourriez-vous m'aider à
Asco on Carex nigra
Simon Gurtner,
22-12-2024 10:19
Hello,can anyone help me identify this small ascomycete?
Found on 01.08.2024 in the Swiss Alps at 2220 m above sea level on Carex nigra.
So far, I have not been able to determine even the genus. Allophylaria is one idea. However, this could not be confirmed by sequencing.
I wish everyone a Merry Christmas and a Happy New Year.
Best regards,
Simon
Here is the sequencing:
AAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGCTCATGCCCCCCGGGGTAGAACTCCACCCTTGCTTGTGCTACCTAGTTGCTTTGGCAGGCCGCTGGCCTACCGTGCCGTGCCTGCCAGAGGTTCTAAACTCGTGTCTCTGAAATCGTCTGAGTAAT ACAAAATTGAATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTAGGTATTCCTGGGGGCATGCCTGTCCGAGCGTCATTAAACACCACTCA AGCTCCGCTTGGTCCTGGGGCGCGCTAGATTTCTAGCGCTCCCTAAACTCAGTGGCGGCGGCTCTCGACCCTCCAGCGCAGTATAACACCTCGCTATGAGATCGGGATCCGCTGGCCAGCAAGCACTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA
Lothar Krieglsteiner,
22-12-2024 10:22
Re : Asco on Carex nigra
why not a Cyathicula? Sometimes it helps to have spores, the reaction of the ascus apex with IKI and some further details.
Simon Gurtner,
22-12-2024 10:35
Re : Asco on Carex nigra
Hi Lothar, when I created the thread, I uploaded the data before I was finished. I have added the missing images. Cyathicula was my first thought macroscopically. However, the microscopy does not fit.
Lothar Krieglsteiner,
22-12-2024 10:45
Re : Asco on Carex nigra
Hello Simon,
ah - I was too fast. Now I see spores - but still not the ascus-apes in IKI. In Allophylaria it ist often (not always) reacting hemiamyloid.
What I already saw are guttulate (dying?) paraphyses what fits for Cyathicula - and for Hymenoscyphus. The excipulum seems more a prismatica than oblita, so o.k. better a Hymenoscyphus. The spores would fit here also better.
Yours, Lothar
ah - I was too fast. Now I see spores - but still not the ascus-apes in IKI. In Allophylaria it ist often (not always) reacting hemiamyloid.
What I already saw are guttulate (dying?) paraphyses what fits for Cyathicula - and for Hymenoscyphus. The excipulum seems more a prismatica than oblita, so o.k. better a Hymenoscyphus. The spores would fit here also better.
Yours, Lothar
Stip Helleman,
22-12-2024 12:51
Re : Asco on Carex nigra
Hi Simon,
to me it looks also as a Cyathicula/Hymenoscyphus, only the sequence does not make any sense. There is no attachment to Helotiaceae in the Multiple sequence ML tree.
Herzliche Gruessen, Frohe Weihnachten und ein gute Rutsch
Stip
Simon Gurtner,
22-12-2024 15:34
Re : Asco on Carex nigra
Hallo Lothar, Hallo Stipe
Danke für eure Hilfe. Zu Beginn habe ich in der Ecke gesucht, bin aber auf kein Ergebniss gekommen. Ich werde es noch einmal da versuchen. Die Sequenz verwirrt mich mehr als es mir hilft.
Grüsse, Simon
Danke für eure Hilfe. Zu Beginn habe ich in der Ecke gesucht, bin aber auf kein Ergebniss gekommen. Ich werde es noch einmal da versuchen. Die Sequenz verwirrt mich mehr als es mir hilft.
Grüsse, Simon