Accès membres

Mot de passe perdu? S'inscrire

06-12-2025 00:19

Viktorie Halasu Viktorie Halasu

Hello, would anyone have this article, please? An

05-12-2025 17:33

Bruno Coué Bruno Coué

Bonjour, je serais heureux de recueillir votre avi

04-12-2025 23:53

Malcolm  Greaves Malcolm Greaves

Is there an up to date Anthracobia key available?T

04-12-2025 21:30

Ethan Crenson

Hello all, I am looking for the following:  Bar

02-12-2025 18:59

Malcolm  Greaves Malcolm Greaves

This pair of ascos 2.5cm across were on recently b

03-12-2025 20:02

Buckwheat Pete

Hello everyone, does anyone know the genus Godroni

02-12-2025 19:25

Buckwheat Pete

Hello, can anyone identify this hairy fungus growi

02-12-2025 14:28

Mirek Gryc

527 / 5 000Hello everyoneThey grew on dead shoots

30-11-2025 12:53

Edvin Johannesen Edvin Johannesen

White short-stipitate apothecia found on thin twig

30-11-2025 10:47

William Slosse William Slosse

I recently found a collection of small Peziza sp.

« < 1 2 3 4 5 > »
coprophilous Scutellinia
Warre Van Caenegem, 14-03-2025 23:29
Good evening everyone. Last year, I found this coprophilous Scutellinia species on bovine dung, near an acidic fen on sandy soil. I generated an ITS sequence, but I found no matches on Genbank, neither I found any morphological match. Could you perhaps help me to identify this collection?

Apothecia up to 5 mm
Hairs mostly bi- or trifurcated, sometimes simple, up to 600 µm, mostly between 300 and 500 µm, septated, the top of the hairs are hyaline,
Asci 205-240 x (12-)15-16 µm, 8-spored
Ascospores (16-)17-19(-20) x 10-12 µm, with regular spaced, low wrats
Found in Belgium, Antwerp, Mol, on 10 April 2024.

ITS has been sequenced, and matches 97,7% with Scutellinia sp. (Genbank Accession numbers MW540903.1 en MW540937.1), and 96,9% with S. fimicola (MW540964.1). The morphology does not match with S. fimicola, because of the smaller spores and the larger asci.

Are there any other fimicolous Scutellinia species known?

>Scutellinia_ITS
ACCCATCTGCGTACATTACCCGTTGCTTCCGCGAGGCAGTGATCTTCGATCACCTC
CCGACGATGGCTTGGGCCNTCCGGTGGGGAGCCCTCGTGAAAGGTTTACACCAA
ACCCTTGCATTTCTATGTCATCTGTCTGAAACTGTTAATAACAAATGTWAAAACTTT
CAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA
GTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGAACATTGCGCC
TCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAATACCACACTCGAGT
CATTTTCGTGGCTCGGTCTTGGGAGAGGAGCGCAACTCGTCTGCCCTCCCTTCCG
AAATCCAATGGCGGAAAGCCCCACGTGCCCCGGCGTAGTAAGTCTTCTTTCGCTC
GGAACGTTTGGCGATCCTGCCGTGAACCCCCCACAAAATCATTTTACAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
Malcolm Greaves, 15-03-2025 10:04
Malcolm  Greaves
Re : coprophilous Scutellinia
In the UK we have had at least 4 species which have been found on dung. Unfortunately none fit your specimen but it shows that at least some of the soil inhabiting species can also grow on dung.
Lothar Krieglsteiner, 15-03-2025 12:08
Lothar Krieglsteiner
Re : coprophilous Scutellinia
my hyperborea/minor from the Alps that I want to re-examine soon was growing on cow dung, too.
I was surprised that it was definitely a Scutellinia and not a Cheilymenia.