Accès membres

Mot de passe perdu? S'inscrire

01-04-2025 23:18

Yanick BOULANGER

BonsoirRécolté par un ami sur dans un tas de bra

29-03-2025 09:08

Martine  Vandeplanque Martine Vandeplanque

Bonjour.J’ai essayé d’étudier un Daldinia.Qu

30-03-2025 10:24

Gonzalez Garcia Marta

Good morning, I would like to know the opinion of

01-04-2025 10:35

Yanick BOULANGER

BonjourSur bois très pourriApothécie 0,2 - 0,5 m

31-03-2025 17:01

akcay mustafa emre

Hello everyone, My name is Mustafa Emre Akçay, a

30-03-2025 12:41

Castillo Joseba Castillo Joseba

Me mandan el material seco de Galicia (España), r

24-03-2025 21:26

éric ROMERO éric ROMERO

Bonjour, J'ai besoin d'une confirmation ou infirm

29-03-2025 21:13

Tomaz Vucko Tomaz Vucko

Hello! I found this Cistella on old stem of Impa

29-03-2025 06:21

Francois Guay Francois Guay

Hi! I found this interesting tiny ascomycete on i

29-03-2025 05:45

Sebastien Basso

Hello, I'm conducting a mycological inventory in

« < 1 2 3 4 5 > »
coprophilous Scutellinia
Warre Van Caenegem, 14-03-2025 23:29
Good evening everyone. Last year, I found this coprophilous Scutellinia species on bovine dung, near an acidic fen on sandy soil. I generated an ITS sequence, but I found no matches on Genbank, neither I found any morphological match. Could you perhaps help me to identify this collection?

Apothecia up to 5 mm
Hairs mostly bi- or trifurcated, sometimes simple, up to 600 µm, mostly between 300 and 500 µm, septated, the top of the hairs are hyaline,
Asci 205-240 x (12-)15-16 µm, 8-spored
Ascospores (16-)17-19(-20) x 10-12 µm, with regular spaced, low wrats
Found in Belgium, Antwerp, Mol, on 10 April 2024.

ITS has been sequenced, and matches 97,7% with Scutellinia sp. (Genbank Accession numbers MW540903.1 en MW540937.1), and 96,9% with S. fimicola (MW540964.1). The morphology does not match with S. fimicola, because of the smaller spores and the larger asci.

Are there any other fimicolous Scutellinia species known?

>Scutellinia_ITS
ACCCATCTGCGTACATTACCCGTTGCTTCCGCGAGGCAGTGATCTTCGATCACCTC
CCGACGATGGCTTGGGCCNTCCGGTGGGGAGCCCTCGTGAAAGGTTTACACCAA
ACCCTTGCATTTCTATGTCATCTGTCTGAAACTGTTAATAACAAATGTWAAAACTTT
CAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA
GTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGAACATTGCGCC
TCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAATACCACACTCGAGT
CATTTTCGTGGCTCGGTCTTGGGAGAGGAGCGCAACTCGTCTGCCCTCCCTTCCG
AAATCCAATGGCGGAAAGCCCCACGTGCCCCGGCGTAGTAAGTCTTCTTTCGCTC
GGAACGTTTGGCGATCCTGCCGTGAACCCCCCACAAAATCATTTTACAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
Malcolm Greaves, 15-03-2025 10:04
Malcolm  Greaves
Re : coprophilous Scutellinia
In the UK we have had at least 4 species which have been found on dung. Unfortunately none fit your specimen but it shows that at least some of the soil inhabiting species can also grow on dung.
Lothar Krieglsteiner, 15-03-2025 12:08
Lothar Krieglsteiner
Re : coprophilous Scutellinia
my hyperborea/minor from the Alps that I want to re-examine soon was growing on cow dung, too.
I was surprised that it was definitely a Scutellinia and not a Cheilymenia.