Accès membres

Mot de passe perdu? S'inscrire

05-06-2026 11:02

Thomas Læssøe

https://svampe.databasen.org/observations/10596691

08-06-2026 10:16

Spooren Marco Spooren Marco

I don`t have a clou about this fungus,it is not in

07-06-2026 15:10

William Slosse William Slosse

Hello everyone,On 05-06-26, I found following asco

07-06-2026 18:18

Mario Schulz

Hello everyone, i found on 31.5 the following Mol

07-06-2026 12:09

François Freléchoux François Freléchoux

Bonjour, Voici une brève description de ce qui m

07-06-2026 12:43

Steve Clements

Bojour. This was a strange find on a stick on my

12-07-2015 00:05

Nedim Jukic Nedim Jukic

This one from the same locality as the previous on

06-06-2026 17:44

Steve Clements

Bonjour, This disco was on planed wood 3 x 1.5 cm

14-08-2016 23:15

Alex Akulov Alex Akulov

Dear friendsCan you help me to find the descriptio

04-06-2026 23:53

Stip Helleman Stip Helleman

Dear all, someone can get acces to this article f

« < 1 2 3 4 5 > »
coprophilous Scutellinia
Warre Van Caenegem, 14-03-2025 23:29
Good evening everyone. Last year, I found this coprophilous Scutellinia species on bovine dung, near an acidic fen on sandy soil. I generated an ITS sequence, but I found no matches on Genbank, neither I found any morphological match. Could you perhaps help me to identify this collection?

Apothecia up to 5 mm
Hairs mostly bi- or trifurcated, sometimes simple, up to 600 µm, mostly between 300 and 500 µm, septated, the top of the hairs are hyaline,
Asci 205-240 x (12-)15-16 µm, 8-spored
Ascospores (16-)17-19(-20) x 10-12 µm, with regular spaced, low wrats
Found in Belgium, Antwerp, Mol, on 10 April 2024.

ITS has been sequenced, and matches 97,7% with Scutellinia sp. (Genbank Accession numbers MW540903.1 en MW540937.1), and 96,9% with S. fimicola (MW540964.1). The morphology does not match with S. fimicola, because of the smaller spores and the larger asci.

Are there any other fimicolous Scutellinia species known?

>Scutellinia_ITS
ACCCATCTGCGTACATTACCCGTTGCTTCCGCGAGGCAGTGATCTTCGATCACCTC
CCGACGATGGCTTGGGCCNTCCGGTGGGGAGCCCTCGTGAAAGGTTTACACCAA
ACCCTTGCATTTCTATGTCATCTGTCTGAAACTGTTAATAACAAATGTWAAAACTTT
CAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA
GTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGAACATTGCGCC
TCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAATACCACACTCGAGT
CATTTTCGTGGCTCGGTCTTGGGAGAGGAGCGCAACTCGTCTGCCCTCCCTTCCG
AAATCCAATGGCGGAAAGCCCCACGTGCCCCGGCGTAGTAAGTCTTCTTTCGCTC
GGAACGTTTGGCGATCCTGCCGTGAACCCCCCACAAAATCATTTTACAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
Malcolm Greaves, 15-03-2025 10:04
Malcolm  Greaves
Re : coprophilous Scutellinia
In the UK we have had at least 4 species which have been found on dung. Unfortunately none fit your specimen but it shows that at least some of the soil inhabiting species can also grow on dung.
Lothar Krieglsteiner, 15-03-2025 12:08
Lothar Krieglsteiner
Re : coprophilous Scutellinia
my hyperborea/minor from the Alps that I want to re-examine soon was growing on cow dung, too.
I was surprised that it was definitely a Scutellinia and not a Cheilymenia.