Accès membres

Mot de passe perdu? S'inscrire

28-04-2026 20:07

Lothar Krieglsteiner Lothar Krieglsteiner

... on twig in the air at standing Ceratonia siliq

05-04-2026 22:46

Lothar Krieglsteiner Lothar Krieglsteiner

on wood of Ceratonia, Algarve, 3.4.2026.The color

10-05-2026 16:18

brigitte vignot

bonjour trouvée  en Ariège sur bois une petite

29-04-2026 10:44

Lothar Krieglsteiner Lothar Krieglsteiner

growing at moist, drying-out soil at the side of a

10-05-2026 23:17

Andreas Gminder Andreas Gminder

Hello,today we found in a moist steep decidous for

27-04-2026 17:16

Lothar Krieglsteiner Lothar Krieglsteiner

.. Algarve, moist lying.The conidiomata look like

10-05-2026 09:02

Buckwheat Pete

Hello everybody, ould this be Lachnum subvirgineu

08-05-2026 11:55

Gernot Friebes

Hi,found on a decorticated Picea abies branch stil

11-05-2016 20:37

Zuzana Sochorová (Egertová) Zuzana Sochorová (Egertová)

Hi,this very little ascomycete grew on soil in a m

09-05-2026 07:37

Zuzana Sochorová (Egertová) Zuzana Sochorová (Egertová)

Hello,please, could anyone share this paper?Ferná

« < 1 2 3 4 5 > »
coprophilous Scutellinia
Warre Van Caenegem, 14-03-2025 23:29
Good evening everyone. Last year, I found this coprophilous Scutellinia species on bovine dung, near an acidic fen on sandy soil. I generated an ITS sequence, but I found no matches on Genbank, neither I found any morphological match. Could you perhaps help me to identify this collection?

Apothecia up to 5 mm
Hairs mostly bi- or trifurcated, sometimes simple, up to 600 µm, mostly between 300 and 500 µm, septated, the top of the hairs are hyaline,
Asci 205-240 x (12-)15-16 µm, 8-spored
Ascospores (16-)17-19(-20) x 10-12 µm, with regular spaced, low wrats
Found in Belgium, Antwerp, Mol, on 10 April 2024.

ITS has been sequenced, and matches 97,7% with Scutellinia sp. (Genbank Accession numbers MW540903.1 en MW540937.1), and 96,9% with S. fimicola (MW540964.1). The morphology does not match with S. fimicola, because of the smaller spores and the larger asci.

Are there any other fimicolous Scutellinia species known?

>Scutellinia_ITS
ACCCATCTGCGTACATTACCCGTTGCTTCCGCGAGGCAGTGATCTTCGATCACCTC
CCGACGATGGCTTGGGCCNTCCGGTGGGGAGCCCTCGTGAAAGGTTTACACCAA
ACCCTTGCATTTCTATGTCATCTGTCTGAAACTGTTAATAACAAATGTWAAAACTTT
CAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAA
GTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGAACATTGCGCC
TCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAATACCACACTCGAGT
CATTTTCGTGGCTCGGTCTTGGGAGAGGAGCGCAACTCGTCTGCCCTCCCTTCCG
AAATCCAATGGCGGAAAGCCCCACGTGCCCCGGCGTAGTAAGTCTTCTTTCGCTC
GGAACGTTTGGCGATCCTGCCGTGAACCCCCCACAAAATCATTTTACAGGTTGAC
CTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
  • message #81923
Malcolm Greaves, 15-03-2025 10:04
Malcolm  Greaves
Re : coprophilous Scutellinia
In the UK we have had at least 4 species which have been found on dung. Unfortunately none fit your specimen but it shows that at least some of the soil inhabiting species can also grow on dung.
Lothar Krieglsteiner, 15-03-2025 12:08
Lothar Krieglsteiner
Re : coprophilous Scutellinia
my hyperborea/minor from the Alps that I want to re-examine soon was growing on cow dung, too.
I was surprised that it was definitely a Scutellinia and not a Cheilymenia.