23-05-2026 11:44
Charles Grapinet
Hello, I am having trouble identifying this copro
25-05-2026 16:44
François BartholomeeusenHi forum members,During an excursion organised by
25-05-2026 16:35
Bernard CLESSE
Bonjour à toutes et tous,J'ai trouvé récemment,
22-05-2026 13:29
Gernot FriebesHi,I am curious to hear your opinion on this mater
23-05-2026 18:57
Sylvie Le GoffBonjour à tousRécolté sur une branchette de Sal
22-05-2026 14:44
Lothar Krieglsteiner
in unripe condition citrine yellow, then soon fadi
22-05-2026 21:35
Steve ClementsBonjour, I expected this find on old wood on our
22-05-2026 18:12
Lothar Krieglsteiner
... in moist chamber from Portugal.As the fungus s
22-05-2026 20:08
Ethan CrensonHello all, Yesterday in NYC I was visiting an e
Hi - I recently sequenced one of my collections from a cloud forest in Veracruz, Mexico. I haven't done any microscopy yet, but I can.
I was surprised to see that there were no close matches. Can anyone turn this ITS sequence into useful information?
Or will I have to do the micro work to figure out what this is?
I could also do LSU sequences....
The ITS sequence is:
CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
here is a phylo-tree genarated by the Blastn of your sequence, which suggests that the closest genus to your fungus could be Phialocephala.
Regards,
Christian
Bonjour Alan,
The genus name proposed by Christian sounds fully exotic to me . I would appreciate closer macro pictures and of course also micros . According to Syllabus of Plant Families, it belongs in the Mollisiaceae families ...
Amitiés
Michel
If you have the fungus fresh, please do it in water, also if it was dried no longer than a few months ago. The spores could still be alive and then give more information.
In my Mollisia tree it falls with great distance near Barrenia and Phialocephala urceolata/Mollisia olivascens, but that could be an accident.
Zotto

Phylo-tree-ITS-Mexico-Ascofrance-Forum-0001.pdf