Hi Viktorie
Close to Pyrenopeziza caespiticia?

Hello Enrique, 

that was one of the names I checked, but I haven't seen such long marginal cells in my fungus and I don't know if the paraphyses and marginal cells can loose VBs entirely when the rest of hymenium is alive. 
But this Piotr's collection seems to be close: http://ascofrance.com/search_forum/3296

Viktorie

I have also no other suggestion. The species is a bit difficult and can easily be misidentified. Nick Aplin wanted in a manuscript to describe a British collection as a new species but I considered it to be P. caespiticia. His unpublished sequence and another by Ingo Wagner/Florian Prell are quite close to each other. But Guy's sequence KY965813 is very distant and I tend to believe that it is Calycina vulgaris.

This fungus appears to be xero-tolerant. In my region this fungus is particularly abundant on Malus branches still attached to the tree. But I never see it on the ones that have fallen to the ground, unless they have fallen after a windstorm.

Bonjour les amis, 

I Used to call this species Mollisia caespiticia , particularly because of the mollisioid paraphyses contents (long VBs staining in CRB) 
Is it based on molecular analysis that you now consider it as a Pyrenopeziza ? 

Amitiés
Michel

Merci Zotto, 
Is there a paper I missed in which it has already been published ? 
IF still keeps Mollisia as current generic name
Michel

Season's greetings everybody,

I didn't publish anything, although I finally came to the conclusion my collections were better refered to as 'Mollisia' caespiticia rather than anything new. Much of the collection data is available in Zotto's Google Drive folders:
Helotiales -> Ploettnerulaceae -> Pyrenopeziza on wood and bark -> caespiticia 4.5-8.5 x 1.5-2 IKI- -> Helotiales 28-IV-2020

As Zotto suggests, the ITS sequence seemed to belong in Heterosphaeraceae rather than anywhere near Mollisia or Pyrenopeziza:

>Helotiales_sp_LGW_28.IV.2020_Salix_Branch
TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTTTTGCCCTAACGGGTAGATCTCCCACCCTTGAATACATACCTTTGTTGCTTTGGCGGGCCGCGCTCGCGCTACTGGCTTGTCTAGTACGTGCCCGCCAGAGGACCACAACTCTTGTTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTATACCACTCAAGCTCAGCTTGGTATTGGGGCCCGCCCACCAGCGGCCCCTAAAGTCAGTGGCGGTGCCGGTCGGCTCTAAGCGTAGTAATACTCCTCGCTATAGGGTCCGGTCGGTTGCTTGCCAACAACCCCAAATTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

This collection seems identical to mine except for the slightly wider spores.

Amités,
Nick

Thanks Nick! In order to obtain a better insight, it is generally useful to compile the available data of samples and to see how far the variation goes. But it is alwaya dangerous when doing a joint description to include finds of different species. So far I did not try.